superscriptiii rnase h reverse transcriptase (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
superscriptiii rnase h reverse transcriptase
Superscriptiii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscriptiii+reverse+transcriptase/Ribonuclease+A/us12611394-210-16-21
Average 99 stars, based on 1 article reviews
Superscriptiii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscriptiii+reverse+transcriptase/Ribonuclease+A/us12611394-210-16-21
Average 99 stars, based on 1 article reviews
superscriptiii rnase h reverse transcriptase - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Reverse Transcription:Article Title: Investigating the reassortment potential and pathogenicity of the S segment in Akabane virus using a reverse genetics system. Article Snippet: Viral RNA was extracted from the cell culture supernatant using the RNeasy Mini Kit (Qiagen, Germany). .. It was then transcribed using Article Title: Pro-ferroptotic lipids as key control points for caveola formation and disassembly. Article Snippet: SYBR-Green or Taqman PCR Mater Mix was utilized for real-time PCR using a ViiA7 Real-time PCR system (ThermoFisher Scientific). .. Two-step reverse transcription was conducted to access single strand cDNA using Article Title: Long-read transcriptomics of caviid gammaherpesvirus 1: compiling a comprehensive RNA atlas. Article Snippet: .. Synthesis of the cDNA strand was performed using Article Title: Investigating the reassortment potential and pathogenicity of the S segment in Akabane virus using a reverse genetics system. Article Snippet: Viral RNA was extracted from virions in the supernatant of Vero cells infected with the AKAV-7 and K0505 strains, using the RNeasy Mini Kit (Qiagen, Germany). .. It was then transcribed by Article Title: System for protein inactivation and recombinant phages for targeted bacterial killing, infection, biodetection, and as a means of protein extraction Article Snippet: Total RNA was isolated from three independent cultures per condition using the RNeasy Mini Kit (Qiagen). .. The samples were treated with DNAse using a TURBO DNA-free Kit (Thermo). cDNA was prepared from 1.5 μg RNA as described (Tu and Bassler, 2007) using Article Title: Dynamic evolution of TCF3‐PBX1 leukemias at the single‐cell level under chemotherapy pressure Article Snippet: RNA was isolated using the AllPrep DNA/RNA Mini Kit (Qiagen). .. RNA was reverse transcribed to single‐stranded complementary DNA with other:Article Title: Early innate immune response and evolution of a SARS-CoV-2 furin cleavage site inactive variant in bat cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Q5 High-Fidelity 2X Master Mix New England Biolabs Cat# M0492L Deposited data Raw and analyzed RNAseq data This paper GEO: GSE285756 Proteomics data This paper PRIDE: PXD058807 Experimental models: Cell lines Vero 76 ATCC Cat# CRL-1587; RRID:CVCL_0603 Vero E6 ATCC Cat# CRL-1586; RRID:CVCL_0574 Vero E6-hTMPRSS2 Xia et al.76 N/A Calu-3 2B4 BEI Resources Cat# NR-55340; RRID:CVCL_YZ47 Calu-3 ATCC Cat# HTB-55; RRID:CVCL_0609 A549 ATCC Cat# CCL-185; RRID:CVCL_0023 A549-hACE2 Clone B9 LeBlanc and Colpitts 109 N/A pEf-Lu (Eptesicus fuscus primary lung cells) This paper N/A Efk3B Banerjee et al.49 N/A Efk3b-hACE2 This paper N/A Efk3B-hACE2+TMPRSS2 This paper N/A RhiLu-hACE2 (Rhinolophus alcyone lung cells) Muth et al.41 N/A HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Oligonucleotides Ra-IFNB F: CTAAGGATCAGGCGGCACTT This paper N/A Ra-IFNB R: AGGCTGGGGATACTCGGTT This paper N/A Ra-OAS1 F: CAAAGTCGTGAAGGGTGGCTC This paper N/A Ra-OAS1 R: AACTTCTGAGGTGGCTGAGG This paper N/A Ra-TNF F: CAGGAGCTACCACGCTTTTC This paper N/A Ra-TNF R: GGGTTCGAGAAGACACTCCAAG This paper N/A Ra-GAPDH F: GACAACTTCGGCATCGTGGA This paper N/A Ra-GAPDH R: TGCCAGTGAGCTTTCCATTGAG This paper N/A Ef-IL6 F: GACCACCACTCACCTCTTCAG This paper N/A Ef-IL6 R: TCTGGCCAGTTTTGGAAGGT This paper N/A Recombinant DNA pHDM-Hgpm2 BEI resources Cat# NR-52517 pHDM-Tat1b BEI resources Cat# NR-52518 pRC-CMV-rev1b BEI resources Cat# NR-52519 pHDM-SARS2-S BEI resources Cat# NR-52514 pLenti-CMV-Puro-Luc Campeau et al. 110 Addgene; Cat# 17477 pCMV-Tag3B-SARS2-Spike This paper N/A pCMV-Tag3B-SARS2-dPRRAP This paper N/A pCMV-Tag3B-SARS2-R685P This paper N/A pcDNA3.1-human furin This paper N/A pcDNA3.1 E.fuscus furin This paper N/A pWPI-IRES-Bla-Ak-ACE2 Gift from Sonja Best Addgene; Cat# 154981 pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 Gift from Sonja Best Addgene; Cat# 154983 Software and algorithms FlowJo v10 BD https://www.flowjo.com FastQC version 11.5 Babraham Institute https://www.bioinformatics.babraham. ac.uk/projects/fastqc/ TrimGalore! |